Introduction

　Since 2024, "Akitakomachi R," a new rice variety developed by Akita Prefecture, has been entering the market. Akitakomachi R carries a one-base deletion in the OsNRAMP5 gene, which encodes a transporter involved in the uptake of heavy metals such as cadmium and manganese. This deletion suppresses cadmium absorption in the plant. The deletion was introduced into the OsNRAMP5 sequence using heavy-ion beam irradiation, producing a line designated "Koshihikari Kan No. 1," which was subsequently used by the Akita Prefectural Agricultural Experiment Station as a parent in developing Akitakomachi R.

　The goal of reducing cadmium intake through food is understandable. However, concerns have been raised about how this variety is handled in the marketplace. Both conventional Akitakomachi and Akitakomachi R are considered substantially equivalent in quality and taste, and no mandatory labeling system distinguishes between the two. As a result, consumers who are concerned about seed rights or other technical issues have no way to identify or avoid Akitakomachi R based on product labels alone.

　It has been reported that from the 2025 (Reiwa 7) growing season onward, the great majority of Akitakomachi seed supplied in Akita Prefecture has been Akitakomachi R. Against this background, the Nouminren Food Analysis Center conducted a PCR-based market survey to determine whether commercially sold Akitakomachi rice is in fact Akitakomachi R, and to investigate the situation for Akitakomachi produced outside Akita Prefecture.

Samples and Testing Method

Between May and June 2026, three commercially available polished rice products labeled "Akitakomachi" and produced in Japan were purchased from supermarkets and tested for variety identification by PCR using SNP-based discriminating markers.

　The primer pairs used were those described in the "High-throughput DNA marker selection protocol ver. 2.0 using the discriminating marker for Koshihikari Kan No. 1," published by the National Agriculture and Food Research Organization (NARO) (NARO protocol page). DNA was extracted using the Monofas Processed Food Kit. Amplification was carried out simultaneously with a rice positive-control primer pair, and results were judged based on the resulting amplification pattern.

　Primers used for identification:
Fwd primer (common)：CCTGTACGAGAGCGGGTTC
Rev primer 1 (conventional variety)：TTTATATTATTATTTATATTATTATTATATTCGAGGCTGAGGTTGGC
Rev primer 2 (Kan No. 1)：CACTCGAGGCTGAGGTTGCG

　These primers detect the OsNRAMP5 sequence carrying a one-base deletion (low-cadmium type) derived from Koshihikari Kan No. 1. A 137 bp amplification product is obtained when this sequence is present; a 164 bp product is obtained when it is absent. If both sequences are present (e.g., in a mixture or hybrid), both bands will appear.

　Since Akitakomachi R was developed using Koshihikari Kan No. 1 as a parent, it also carries the low-cadmium OsNRAMP5 sequence. Accordingly, detection of the 137 bp product was classified as "Identified as Akitakomachi R," while detection of the 164 bp product only was classified as "Identified as conventional Akitakomachi."

Results

　Results are shown below. Of the three products tested, one (produced in Akita Prefecture) showed an amplification pattern consistent with Akitakomachi R.

Table 1　Results of Akitakomachi R Identification in Commercial Akitakomachi Rice — 2026, 1st Report

Sample No.	Photo	Product	Origin / Seller	Result
S1	(Reverse)	Polished Rice, Akitakomachi, Harvest Year 7 Lot. EACBE SKR65449 0071	Akita Prefecture Nogami Beikoku Co., Ltd.	Identified as Akitakomachi R
S2	(Reverse)	Polished Rice, Akitakomachi, Harvest Year 7 Lot. 06NLMH	Iwate Prefecture Nanbu Co., Ltd.	Identified as conventional Akitakomachi
S3	(Reverse)	Polished Rice, Akitakomachi, Harvest Year 7 Lot. SJCJCE 0309	Ibaraki Prefecture Murase Co., Ltd.	Identified as conventional Akitakomachi

（Analysis No. 126375 / Analysis completed: June 11, 2026 / Analyst: Kazuishi Sakamoto）

Discussion

　Of the three products tested, one Akita Prefecture product (Nogami Beikoku Co., Ltd.) was identified as Akitakomachi R. The remaining two products — from Iwate Prefecture (Nanbu Co., Ltd.) and Ibaraki Prefecture (Murase Co., Ltd.) — were identified as conventional Akitakomachi.

　Akitakomachi R has been distributed mainly in Akita Prefecture since 2024. This result is consistent with Akita Prefecture's own announcements that the shift to Akitakomachi R cultivation is underway. Products from other prefectures tested here were confirmed to be the conventional variety. While the number of samples is too small to draw broad conclusions, this result tentatively suggests that Akitakomachi R seed has not yet spread significantly to cultivation areas outside Akita Prefecture.

　At present, Akitakomachi R is not labeled as such at the point of sale. The Akita Prefecture product tested in this survey carried no indication on its packaging that it was Akitakomachi R. Under the current labeling system, consumers who wish to avoid Akitakomachi R are left without a reliable means to do so — although this survey suggests that choosing Akitakomachi from prefectures other than Akita may currently be one available option.

　The Nouminren Food Analysis Center will continue to monitor the commercial distribution of Akitakomachi products. We welcome your support for our research activities (Online Donation Page).

Related Links

Revision History

About the Nouminren Food Analysis Center

　The Nouminren Food Analysis Center is a rare institution worldwide — established in 1996 through donations from farmers and consumers. Because it was built on public donations rather than corporate or government funding, it operates independently, free from external influence.

　Since our founding in 1996, our survey activities have been sustained entirely by donations. We will be frank: our finances are tight. To continue standing on the side of consumers and farmers, we depend on your support.

　We are recruiting "Analysis Center Supporter Members." Annual membership starts from 5,000 yen per unit. Please help sustain our work.

"Analysis Support Donation" and "Supporter Member Registration" (via Congrant donation service)